Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2374864
End position: 2374890
Length: 27

DNA sequence
>NC_009338, from 2374864 to 2374890 (27 bp); Mycobacterium gilvum PYR-GCK GCGGCGTCGGCGGCATCGGCGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2374672-2375751	Sequence	Mflv_2285 - hypothetical protein (Protein is coded in complementary strand; from 2375751 to 2374672)