Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2319225
End position: 2319251
Length: 27

DNA sequence
>NC_009338, from 2319225 to 2319251 (27 bp); Mycobacterium gilvum PYR-GCK AGCGCGGCGAGCGCGGCCAGCACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2318334-2319572	Sequence	Mflv_2234 - H+ antiporter protein (Protein is coded in complementary strand; from 2319572 to 2318334)