Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2255606
End position: 2255632
Length: 27

DNA sequence
>NC_009338, from 2255606 to 2255632 (27 bp); Mycobacterium gilvum PYR-GCK GCCGCCGGTGCCGCCGGTGCCGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2255151-2256620	Sequence	Mflv_2178 - hypothetical protein (Protein is coded in complementary strand; from 2256620 to 2255151)