Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1697091
End position: 1697117
Length: 27

DNA sequence
>NC_009338, from 1697091 to 1697117 (27 bp); Mycobacterium gilvum PYR-GCK CGTCGGGGTCGTCGGTGTCGTCGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1697027-1698061	Sequence	Mflv_1627 - Dyp-type peroxidase family protein (Protein is coded in complementary strand; from 1698061 to 1697027)