Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1423659
End position: 1423685
Length: 27

DNA sequence
>NC_009338, from 1423659 to 1423685 (27 bp); Mycobacterium gilvum PYR-GCK TGGAGCGGCTGGAGCGGCTGGAGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1423686-1424816	Sequence	Mflv_1367 - anion-transporting ATPase (Protein is coded in complementary strand; from 1424816 to 1423686)