Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 821641
End position: 821664
Length: 24

DNA sequence
>NC_009338, from 821641 to 821664 (24 bp); Mycobacterium gilvum PYR-GCK GAACGCGAACGCGAAGGCGAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 820280-821731	Sequence	Mflv_0800 - amino acid permease-associated protein (Protein is coded in complementary strand; from 821731 to 820280)