Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 721364
End position: 721387
Length: 24

DNA sequence
>NC_009338, from 721364 to 721387 (24 bp); Mycobacterium gilvum PYR-GCK CGGGCTCGGGCTCGGGGTCGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 720817-721746	Sequence	Mflv_0702 - hypothetical protein (Protein is coded in complementary strand; from 721746 to 720817)