Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5616643
End position: 5616666
Length: 24

DNA sequence
>NC_009338, from 5616643 to 5616666 (24 bp); Mycobacterium gilvum PYR-GCK GCAACGGCAGCGGCATCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5615955-5617580	Sequence	Mflv_5271 - AMP-dependent synthetase and ligase (Protein is coded in complementary strand; from 5617580 to 5615955)