Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5554797
End position: 5554820
Length: 24

DNA sequence
>NC_009338, from 5554797 to 5554820 (24 bp); Mycobacterium gilvum PYR-GCK AACACCAGCACCAACGCCAGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5554380-5555834	Sequence	Mflv_5210 - protein kinase (Protein is coded in complementary strand; from 5555834 to 5554380)