Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5522151
End position: 5522174
Length: 24

DNA sequence
>NC_009338, from 5522151 to 5522174 (24 bp); Mycobacterium gilvum PYR-GCK CATCGGCATCGGCATCGGCATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5521313-5522503	Sequence	Mflv_5179 - hypothetical protein (Protein is coded in complementary strand; from 5522503 to 5521313)