Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5515588
End position: 5515611
Length: 24

DNA sequence
>NC_009338, from 5515588 to 5515611 (24 bp); Mycobacterium gilvum PYR-GCK AGGGCGAGGTCGAGGTCGAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5514892-5517003	Sequence	Mflv_5174 - PAS/PAC and GAF sensor-containing diguanylate cyclase/phosphodiesterase (Protein is coded in complementary strand; from 5517003 to 5514892)