Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 540978
End position: 541001
Length: 24

DNA sequence
>NC_009338, from 540978 to 541001 (24 bp); Mycobacterium gilvum PYR-GCK CACCGGCACCGGCACCGGCACCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 540887-542086	Sequence	Mflv_0507 - ABC transporter periplasmic solute-binding protein