Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5246006
End position: 5246029
Length: 24

DNA sequence
>NC_009338, from 5246006 to 5246029 (24 bp); Mycobacterium gilvum PYR-GCK TGGCCGTGACCGTGGCCGTGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5245994-5247619	Sequence	Mflv_4924 groEL chaperonin GroEL (Protein is coded in complementary strand; from 5247619 to 5245994)