Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5112315
End position: 5112338
Length: 24

DNA sequence
>NC_009338, from 5112315 to 5112338 (24 bp); Mycobacterium gilvum PYR-GCK TCGAGGTCGACGTCGAAGTCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5112186-5112563	Sequence	Mflv_4805 - hypothetical protein (Protein is coded in complementary strand; from 5112563 to 5112186)