Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5053479
End position: 5053502
Length: 24

DNA sequence
>NC_009338, from 5053479 to 5053502 (24 bp); Mycobacterium gilvum PYR-GCK CACCGTCACCGTGACCGTCACCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5052632-5054632	Sequence	Mflv_4744 - putative outer membrane adhesin like protein