Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5046632
End position: 5046655
Length: 24

DNA sequence
>NC_009338, from 5046632 to 5046655 (24 bp); Mycobacterium gilvum PYR-GCK GAGGCCGAGCCCGAGGCGCAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5046186-5047667	Sequence	Mflv_4737 - cell envelope-related transcriptional attenuator