Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5027132
End position: 5027155
Length: 24

DNA sequence
>NC_009338, from 5027132 to 5027155 (24 bp); Mycobacterium gilvum PYR-GCK CGATGTCGATCTCGTTGTCGAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5026756-5028216	Sequence	Mflv_4717 - S-adenosyl-L-homocysteine hydrolase (Protein is coded in complementary strand; from 5028216 to 5026756)