Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 4222155
End position: 4222178
Length: 24

DNA sequence
>NC_009338, from 4222155 to 4222178 (24 bp); Mycobacterium gilvum PYR-GCK CGGCGGCGGCGTCGACGGCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4221665-4222606	Sequence	Mflv_3962 miaA tRNA delta(2)-isopentenylpyrophosphate transferase (Protein is coded in complementary strand; from 4222606 to 4221665)