Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 4054569
End position: 4054592
Length: 24

DNA sequence
>NC_009338, from 4054569 to 4054592 (24 bp); Mycobacterium gilvum PYR-GCK GGCGTACGCGTAGGCGTCGGCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4054360-4054788	Sequence	Mflv_3797 - hypothetical protein (Protein is coded in complementary strand; from 4054788 to 4054360)