Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 402987
End position: 403010
Length: 24

DNA sequence
>NC_009338, from 402987 to 403010 (24 bp); Mycobacterium gilvum PYR-GCK GCAGCAGCAGCATCAGCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 402506-405511	Sequence	Mflv_0403 - transport protein (Protein is coded in complementary strand; from 405511 to 402506)