Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3976176
End position: 3976199
Length: 24

DNA sequence
>NC_009338, from 3976176 to 3976199 (24 bp); Mycobacterium gilvum PYR-GCK GGCGACGGCGAACGCGACGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3975481-3976482	Sequence	Mflv_3727 - riboflavin biosynthesis protein RibD (Protein is coded in complementary strand; from 3976482 to 3975481)