Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3961393
End position: 3961416
Length: 24

DNA sequence
>NC_009338, from 3961393 to 3961416 (24 bp); Mycobacterium gilvum PYR-GCK CGTTGTCGATGTCGTTCTCGTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3960510-3961493	Sequence	Mflv_3714 - hypothetical protein (Protein is coded in complementary strand; from 3961493 to 3960510)