Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3933527
End position: 3933550
Length: 24

DNA sequence
>NC_009338, from 3933527 to 3933550 (24 bp); Mycobacterium gilvum PYR-GCK CCGTCGTCGTCGCCGTCTCCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3932678-3933616	Sequence	Mflv_3685 - hypothetical protein (Protein is coded in complementary strand; from 3933616 to 3932678)