Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3839702
End position: 3839725
Length: 24

DNA sequence
>NC_009338, from 3839702 to 3839725 (24 bp); Mycobacterium gilvum PYR-GCK GCCTCGGTCTCGGCGTCGGCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3839213-3841516	Sequence	Mflv_3597 - prolipoprotein diacylglyceryl transferase (Protein is coded in complementary strand; from 3841516 to 3839213)