Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3837901
End position: 3837924
Length: 24

DNA sequence
>NC_009338, from 3837901 to 3837924 (24 bp); Mycobacterium gilvum PYR-GCK CGGCGGCGGCAGCGGCGCCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3837722-3839116	Sequence	Mflv_3596 - hypothetical protein (Protein is coded in complementary strand; from 3839116 to 3837722)