Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3683545
End position: 3683568
Length: 24

DNA sequence
>NC_009338, from 3683545 to 3683568 (24 bp); Mycobacterium gilvum PYR-GCK TCGGCGGCGGCGTCGGCATCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3681871-3683934	Sequence	Mflv_3458 - type I phosphodiesterase/nucleotide pyrophosphatase (Protein is coded in complementary strand; from 3683934 to 3681871)