Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3663685
End position: 3663708
Length: 24

DNA sequence
>NC_009338, from 3663685 to 3663708 (24 bp); Mycobacterium gilvum PYR-GCK CCCGCAACCGCAGCCGCACCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3662256-3664619	Sequence	Mflv_3444 - RNA-binding S1 domain-containing protein (Protein is coded in complementary strand; from 3664619 to 3662256)