Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3640973
End position: 3640996
Length: 24

DNA sequence
>NC_009338, from 3640973 to 3640996 (24 bp); Mycobacterium gilvum PYR-GCK CTTCGACTTCGACTTCGACTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3640189-3642051	Sequence	Mflv_3422 - hypothetical protein (Protein is coded in complementary strand; from 3642051 to 3640189)