Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3547855
End position: 3547878
Length: 24

DNA sequence
>NC_009338, from 3547855 to 3547878 (24 bp); Mycobacterium gilvum PYR-GCK GCCAGCGGCAGCGTCAGCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3546616-3548151	Sequence	Mflv_3362 - binding-protein-dependent transport systems inner membrane component (Protein is coded in complementary strand; from 3548151 to 3546616)