Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3225093
End position: 3225116
Length: 24

DNA sequence
>NC_009338, from 3225093 to 3225116 (24 bp); Mycobacterium gilvum PYR-GCK GACGACGACGACGCCGACGCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3224785-3225597	Sequence	Mflv_3046 - phosphatidylinositol 3- and 4-kinase catalytic subunit