Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3104111
End position: 3104134
Length: 24

DNA sequence
>NC_009338, from 3104111 to 3104134 (24 bp); Mycobacterium gilvum PYR-GCK GGGCTTCGGCTTGGGCTCGGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3103113-3104957	Sequence	Mflv_2935 - dihydrolipoamide acetyltransferase (Protein is coded in complementary strand; from 3104957 to 3103113)