Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3085689
End position: 3085712
Length: 24

DNA sequence
>NC_009338, from 3085689 to 3085712 (24 bp); Mycobacterium gilvum PYR-GCK CATCGGCATCGGCATCGGCATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3082769-3085972	Sequence	Mflv_2913 - YVTN beta-propeller repeat-containing protein (Protein is coded in complementary strand; from 3085972 to 3082769)