Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3018967
End position: 3018990
Length: 24

DNA sequence
>NC_009338, from 3018967 to 3018990 (24 bp); Mycobacterium gilvum PYR-GCK GCGGGCGAGGGCGCGGGCGAGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3018362-3019441	Sequence	Mflv_2856 - ABC transporter-like protein (Protein is coded in complementary strand; from 3019441 to 3018362)