Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2925688
End position: 2925711
Length: 24

DNA sequence
>NC_009338, from 2925688 to 2925711 (24 bp); Mycobacterium gilvum PYR-GCK GCGGCGACGGCGCCGGCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2925286-2926215	Sequence	Mflv_2779 - (acyl-carrier protein) S-malonyltransferase (Protein is coded in complementary strand; from 2926215 to 2925286)