Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2718973
End position: 2718996
Length: 24

DNA sequence
>NC_009338, from 2718973 to 2718996 (24 bp); Mycobacterium gilvum PYR-GCK CGGCGTCGACGTCGGCGTCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2718132-2719181	Sequence	Mflv_2598 - inositol 2-dehydrogenase (Protein is coded in complementary strand; from 2719181 to 2718132)