Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 263045
End position: 263068
Length: 24

DNA sequence
>NC_009338, from 263045 to 263068 (24 bp); Mycobacterium gilvum PYR-GCK GCCGCCGCCGTCGGCGCCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 262716-263732	Sequence	Mflv_0274 - hypothetical protein (Protein is coded in complementary strand; from 263732 to 262716)