Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2562963
End position: 2562986
Length: 24

DNA sequence
>NC_009338, from 2562963 to 2562986 (24 bp); Mycobacterium gilvum PYR-GCK TCGAACACGAACCCGAACGCGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2562441-2563607	Sequence	Mflv_2459 - hypothetical protein (Protein is coded in complementary strand; from 2563607 to 2562441)