Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2289242
End position: 2289265
Length: 24

DNA sequence
>NC_009338, from 2289242 to 2289265 (24 bp); Mycobacterium gilvum PYR-GCK CGACGACGCCGAGGACGACGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2289115-2289822	Sequence	Mflv_2210 - hypothetical protein (Protein is coded in complementary strand; from 2289822 to 2289115)