Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2273887
End position: 2273910
Length: 24

DNA sequence
>NC_009338, from 2273887 to 2273910 (24 bp); Mycobacterium gilvum PYR-GCK CACCAGCACGAGCACCGGAACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2273810-2274400	Sequence	Mflv_2195 - hypothetical protein (Protein is coded in complementary strand; from 2274400 to 2273810)