Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2224270
End position: 2224293
Length: 24

DNA sequence
>NC_009338, from 2224270 to 2224293 (24 bp); Mycobacterium gilvum PYR-GCK GGGGCCGGGCCCGGTGCCGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2223754-2224788	Sequence	Mflv_2151 - hypothetical protein (Protein is coded in complementary strand; from 2224788 to 2223754)