Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2119773
End position: 2119796
Length: 24

DNA sequence
>NC_009338, from 2119773 to 2119796 (24 bp); Mycobacterium gilvum PYR-GCK CGAGCCGACGCGCCGACGGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2119313-2120275	Sequence	Mflv_2041 - GDSL family lipase (Protein is coded in complementary strand; from 2120275 to 2119313)