Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2030387
End position: 2030410
Length: 24

DNA sequence
>NC_009338, from 2030387 to 2030410 (24 bp); Mycobacterium gilvum PYR-GCK CCGAGTCCGCGTCCGAGCCCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2029451-2030413	Sequence	Mflv_1949 - nucleoside triphosphate pyrophosphohydrolase