Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1837489
End position: 1837512
Length: 24

DNA sequence
>NC_009338, from 1837489 to 1837512 (24 bp); Mycobacterium gilvum PYR-GCK CGGCGACGGCGGTGGCGACGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1837119-1838177	Sequence	Mflv_1766 - dihydrodipicolinate reductase (Protein is coded in complementary strand; from 1838177 to 1837119)