Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1732856
End position: 1732879
Length: 24

DNA sequence
>NC_009338, from 1732856 to 1732879 (24 bp); Mycobacterium gilvum PYR-GCK GGGCTCGGGTTCGGGTTCGGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1731174-1733123	Sequence	Mflv_1666 - cell envelope-related transcriptional attenuator (Protein is coded in complementary strand; from 1733123 to 1731174)