Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1642662
End position: 1642685
Length: 24

DNA sequence
>NC_009338, from 1642662 to 1642685 (24 bp); Mycobacterium gilvum PYR-GCK CGCGGTCACGGTCGCGGCAGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1642222-1642947	Sequence	Mflv_1572 - carbon monoxide dehydrogenase subunit G (Protein is coded in complementary strand; from 1642947 to 1642222)