Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1503866
End position: 1503889
Length: 24

DNA sequence
>NC_009338, from 1503866 to 1503889 (24 bp); Mycobacterium gilvum PYR-GCK ACGCGATCGCGAGCGCGACCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1503601-1505004	Sequence	Mflv_1442 - DNA repair protein RadA (Protein is coded in complementary strand; from 1505004 to 1503601)