Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1461920
End position: 1461943
Length: 24

DNA sequence
>NC_009338, from 1461920 to 1461943 (24 bp); Mycobacterium gilvum PYR-GCK GCGACCCCGACCGCGGCCGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1460945-1462216	Sequence	Mflv_1402 - hypothetical protein (Protein is coded in complementary strand; from 1462216 to 1460945)