Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1343156
End position: 1343179
Length: 24

DNA sequence
>NC_009338, from 1343156 to 1343179 (24 bp); Mycobacterium gilvum PYR-GCK CGCAGCCGCAACCGCTGCCGAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1342544-1343260	Sequence	Mflv_1290 - glutamine amidotransferase (Protein is coded in complementary strand; from 1343260 to 1342544)