Sequence retrieval

Genome: Prosthecochloris vibrioformis DSM 265
Start position: 321828
End position: 321890
Length: 63

DNA sequence
>NC_009337, from 321828 to 321890 (63 bp); Prosthecochloris vibrioformis DSM 265 AACGCTGTGGCTGTTGGACTGAGCGCTGCGGCTGTTGGACTGAGCGCTGCGGCTGTTGGACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 320389-324273	Sequence	Cvib_0318 - magnesium chelatase subunit H (Protein is coded in complementary strand; from 324273 to 320389)