Sequence retrieval

Genome: Prosthecochloris vibrioformis DSM 265
Start position: 1615010
End position: 1615045
Length: 36

DNA sequence
>NC_009337, from 1615010 to 1615045 (36 bp); Prosthecochloris vibrioformis DSM 265 AACAGAAGAGCGACCAGAAGACCGAGCAGAAGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1614362-1615267	Sequence	Cvib_1448 - inner-membrane translocator (Protein is coded in complementary strand; from 1615267 to 1614362)